Processing math: 100%

Identifying Maximal Repeats solved by 237

Aug. 23, 2012, midnight by btjaden

Topics: Graph Algorithms, String Algorithms

Spies in the War Against Phagesclick to expand

Figure 1. A genomic region containing a CRISPR. Red substrings correspond to CRISPR repeats, and blue substrings correspond to unique spacers. Repeats are highly palindromic and fold into a hairpin loop when transcribed.

In “Locating Restriction Sites”, we saw how one weapon used by bacteria in their age-old fight with phages is the use of restriction enzymes. Another defense mechanism found in the genomes of most bacteria and archaea centers on intervals of DNA called CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), which allow the cell to distinguish its own DNA from that of phages or plasmids.

Specifically, a CRISPR is an interval of DNA consisting of identical repeats (approximately 23 to 47 bp long), alternating with unique intervals (approximately 21 to 72 bp long) called spacers; see Figure 1. Spacers correspond to fragments of foreign DNA that were integrated into the genome between repeats and serve as a memory bank for genetic material captured from invading phages. As a result, spacers can be used to recognize and silence invasive elements.

Specifically, CRISPRs are transcribed into RNA molecules, each consisting of a spacer flanked by partial repeats. The small CRISPR RNAs, together with associated proteins translated from this RNA, target foreign DNA that matches the CRISPR spacer. In eukaryotes, a similar process is achieved by a process called RNA interference (RNAi).

To locate a CRISPR in a genome, we need to search for its repeats. We have already located long repeats in “Finding the Longest Multiple Repeat”, but the case here is different because of the repeats appearing in CRISPRS are relatively short. Instead, we are looking for repeated intervals that cannot be lengthened in either direction (otherwise, we would intersect with a spacer).

Problem

A maximal repeat of a string s is a repeated substring t of s having two occurrences t1 and t2 such that t1 and t2 cannot be extended by one symbol in either direction in s and still agree.

For example, "AG" is a maximal repeat in "TAGTTAGCGAGA" because even though the first two occurrences of "AG" can be extended left into "TAG", the first and third occurrences differ on both sides of the repeat; thus, we conclude that "AG" is a maximal repeat. Note that "TAG" is also a maximal repeat of "TAGTTAGCGAGA", since its only two occurrences do not still match if we extend them in either direction.

Given: A DNA string s of length at most 1 kbp.

Return: A list containing all maximal repeats of s having length at least 20.

Sample Dataset

TAGAGATAGAATGGGTCCAGAGTTTTGTAATTTCCATGGGTCCAGAGTTTTGTAATTTATTATATAGAGATAGAATGGGTCCAGAGTTTTGTAATTTCCATGGGTCCAGAGTTTTGTAATTTAT

Sample Output

TAGAGATAGAATGGGTCCAGAGTTTTGTAATTTCCATGGGTCCAGAGTTTTGTAATTTAT
ATGGGTCCAGAGTTTTGTAATTT

Hintclick to expand

How can we use the suffix tree of s to find maximal repeats?

Please login to solve this problem.