Overlap Alignment solved by 274

Feb. 1, 2013, 3:37 p.m. by Rosalind Team

Topics: Alignment, Dynamic Programming

Overlapping Reads with Errors

As also mentioned in “Error Correction in Reads”, the sequencing machines that identify reads can make errors. However, the problem that we considered in “Genome Assembly as Shortest Superstring” assumed that all reads are error-free.

Thus, rather than trying to overlap reads exactly, we will instead do so approximately. The key to do this is to move toward methods that incorporate alignments. Yet neither global nor local alignment is appropriate for this task. Global alignment will attempt to align the entire reads, when we know that only the overlapping parts of the reads are relevant. For that matter, we may identify an optimal local alignment that does not correspond to an overlap.

As a result, we need a specific type of local alignment that aligns only the overlapping parts of two strings.

Problem

An overlap alignment between two strings $s$ and $t$ is a local alignment of a suffix of $s$ with a prefix of $t$. An optimal overlap alignment will therefore maximize an alignment score over all such substrings of $s$ and $t$.

The term "overlap alignment" has also been used to describe what Rosalind defines as a semiglobal alignment. See “Semiglobal Alignment” for details.

Given: Two DNA strings $s$ and $t$ in FASTA format, each having length at most 10 kbp.

Return: The score of an optimal overlap alignment of $s$ and $t$, followed by an alignment of a suffix $s'$ of $s$ and a prefix $t'$ of $t$ achieving this optimal score. Use an alignment score in which matching symbols count +1, substitutions count -2, and there is a linear gap penalty of 2. If multiple optimal alignments exist, then you may return any one.

Sample Dataset

>Rosalind_54
CTAAGGGATTCCGGTAATTAGACAG
>Rosalind_45
ATAGACCATATGTCAGTGACTGTGTAA

Sample Output

1
ATTAGAC-AG
AT-AGACCAT

Citation

This problem follows Jones & Pevzner, An Introduction to Bioinformatics Algorithms, problem 6.22.

Please login to solve this problem.