Suggested problems

Problem Suggested By Suggest Date
+70
Synonymous SNPs Dennis Farr Oct. 15, 2012
+34
Coverage in Genome Sequencing Arthi Ramachandran Jan. 11, 2013
+16
Counting k-mers Aleksey Kladov Sept. 9, 2012
+14
Protein Motifs Mike Rayko Oct. 11, 2012
+11
Chromosome walking (Old-school sequencing) Mike Rayko Oct. 10, 2012
+10
Searching For Most Likely Pattern mariel.21 Oct. 12, 2012
+9
Hydropathy index Wouter Saelens Dec. 30, 2012
+7
Move-to-front transform (decode) Maxim Oct. 10, 2012
+7
Co occurring TFBS in DAN Summaira July 7, 2015
+4
Six ways to translate DNA Robert Goldberg-Alberts Dec. 17, 2015
+4
Manhattan distance of two DNA Topu Dash Roy April 13, 2018
+3
Fetch out the genomic element between provided range in the geneome abuzar hamza June 5, 2013
+1
Using Try And Except Statements Hayden Cooper Stites April 15, 2015
+1
Install pypy Simon Crase Jan. 26, 2021
0
essayez d'organiser un événement décontracté le lendemain du mariage goodrobe.fr Aug. 3, 2021
0
Black Magic Black Magic Specialist Astrologer Aug. 3, 2021
0
Giới thiệu dự án Hải Giang Merry Land Hải Giang Merry Land Aug. 3, 2021
0
Giới thiệu dự án Hải Giang Merry Land Hải Giang Merry Land Aug. 3, 2021
0
Giới thiệu dự án Hải Giang Merry Land Hải Giang Merry Land Aug. 3, 2021
0
Will Cash App Refund Money If Scammed erratically? harryporter Aug. 5, 2021
0
Will Cash App Refund Money If Scammed erratically? harryporter Aug. 5, 2021
0
Oracle SOA Online Certification Training Zaid md Aug. 7, 2021
0
sphynx kittens for sale janetlopez Aug. 10, 2021
0
sphynx kittens for sale janetlopez Aug. 10, 2021
0
Business Setup in Dubai | Company Formation in UAE | Free Zone Setup Business In Dubai Aug. 10, 2021
0
how to take care of sphynx kittens janetlopez Aug. 10, 2021
0
how to take care of sphynx kittens janetlopez Aug. 10, 2021
0
Attributes of cash app customer service team: stuardboard Aug. 11, 2021
0
Working strategy of cash app customer service team: stuardboard Aug. 11, 2021
0
Seek out impact of cash app customer service team: stuardboard Aug. 11, 2021
0
Best Astrologer in chennai online Alka Ajith Aug. 13, 2021
0
How to utilize the facility of Cash app customer service? stuardboard Aug. 13, 2021
0
Crucial factors of Cash app customer service features: stuardboard Aug. 13, 2021
0
How Hard It Is To Unlock Cash App Account If A New User? stuardboard Aug. 13, 2021
0
mais restez fidèle à vous-même et cela se verra le jour de votre mariage goodrobe.fr Aug. 18, 2021
0
Best IVF Centres in India with Low IVF Cost in India | Vinsfertility Vinsfertility Aug. 18, 2021
0
vidalista 20 Tadarise 20 mg Aug. 20, 2021
0
vidalista 20 Tadarise 20 mg Aug. 20, 2021
0
vidalista 20 Tadarise 20 mg Aug. 20, 2021
0
Why is an eCommerce Website important for your Business! KitoInfocom Aug. 24, 2021
0
Buy Adderall Online Overnight No Rx in USA | Tramadolus.org TramadolUS Aug. 24, 2021
0
à fournir la plus belle copie papier de votre mariage à chérir goodrobe.fr Aug. 25, 2021
0
Can the sender cancel a Cash App payment when required? Kingmark Aug. 25, 2021
0
Robinhood customer service team-avail of solution service at once: Kingmark Aug. 25, 2021
0
Can you chat with Chime to resolve tech problems? Kingmark Aug. 25, 2021
0
Understand The Entire Scenario About How Long Does Cash App Take To Respond kimberlyscott Sept. 2, 2021
0
Now Make Your Account Robust Through Cash App Phone Number kimberlyscott Sept. 2, 2021
0
Buy lives at low prices for a limited time manelnunez875 Sept. 2, 2021
0
Compute Count(ACTGTACGATGATGTGTGTCAAAG, TGT). 0 / 2 points RawanAlhazaimeh Sept. 4, 2021
0
Compute Count(ACTGTACGATGATGTGTGTCAAAG, TGT) RawanAlhazaimeh Sept. 4, 2021
0
What is the most frequent 3-mer of TAAACGTGAGAGAAACGTGCTGATTACACTTGTTCGTGTGGTAT? RawanAlhazaimeh Sept. 4, 2021
0
Question 5 Solve the Pattern Matching Problem with Text = ATGACTTCGCTGTTACGCGC and Pattern = CGC to find all starting positions of Pattern in Text. Return the starting positions in increasing order RawanAlhazaimeh Sept. 4, 2021
0
How To Make Adult fanclub app development? michalewilliam Sept. 4, 2021
0
BEST SERVICES FOR DRIVERS LICENSE ONLINE andersonlarry597 Sept. 5, 2021
0
best email marketing tool - wphostingmag wphostingmag Sept. 6, 2021
0
How does homework help you prepare for tests? rosie4 Sept. 6, 2021
0
Why codeigniter is Good for Website Development ? web development india Sept. 7, 2021
0
Speedy Grade kimberlykeller Sept. 9, 2021
0
Speedy Grade kimberlykeller Sept. 9, 2021
0
AutoCAD Crack Version + License Key [Latest Version] Ozum Sept. 9, 2021
0
put solutions for the problems saysbad5 Sept. 12, 2021
0
Buy Ambien 10mg Legally Online With Overnight Free Shipping | Shop From Buy Xanax Pill mangolialexa Sept. 14, 2021
0
VIP Escort in Greater Kailash Escorts akku Sept. 14, 2021
0
Free Software for Download Usman Hayat Sept. 17, 2021
0
Lumion Pro Crack Usman Hayat Sept. 17, 2021
0
Can I get programming assignment help online? David Wayne Sept. 18, 2021
0
VirtualDJ 9 Crack Usman Hayat Sept. 19, 2021
0
Bellsouth Net Email Login - Sign in robert23 Sept. 19, 2021
0
komarla brigade residency Brigade Komarla Heights Sept. 20, 2021
0
Cash app customer service facility-get solution right now: Kim kardasia Sept. 20, 2021
0
How To Check My Chime Balance If Facing Any Issue For The First Time? Kim kardasia Sept. 20, 2021
0
STP for residential buildings AmitS0007 Sept. 21, 2021
0
How Do I Get My Money Back From Cash App To Your Wallet? alicebailey Sept. 21, 2021
0
Gmail not receiving email marieorpos Sept. 23, 2021
-1
http://www.alisharoy.biz bookalisharoy Dec. 25, 2020
-1
best pay per click advertising companies Reflekt Visual Jan. 8, 2021
-1
Cenforce 100 review Jaime_Corbett Jan. 11, 2021
-1
How To Get A Printer Online? aleon jhon Jan. 12, 2021
-1
CENFORCE 100MG | Review|Uses|Side Effect Genericpharmamall Jan. 13, 2021
-1
Kamagra 100 Jaime_Corbett Jan. 19, 2021
-1
Fildena 100 mg Jaime_Corbett Jan. 27, 2021
-1
App Developers Canada Julia Johnson Jan. 28, 2021
-1
Quickbooks Database server manager kevinmalone231 Jan. 29, 2021
-1
John is planning to plant trees in the city kiransam Jan. 30, 2021
-1
routerlogin.net | www.routerlogin.net | 192.168.1.1 login | Router Login routerlogin.net Feb. 2, 2021
-1
Careprost online Jaime_Corbett Feb. 2, 2021
-1
Goof in the tab the clarification for Cash App issue? Interface with Cash App customer service care. Akila le Feb. 4, 2021
-1
Wildest Tour With Call Girls In Solan daynightlove Feb. 4, 2021
-1
123.hp.com/setup 123.hp.com/setup Feb. 4, 2021
-1
www.trendmicro.com/bestbuypc trendmicro Feb. 4, 2021
-1
Quickbooks error 15241 windows 10 Ross taylor Feb. 6, 2021
-1
How Do I Sign-In to Cox webmail account? Henry Max Feb. 6, 2021
-1
A Rapid Introduction to Molecular Biology in Data Science kiransam Feb. 6, 2021
-1
Call girl service Prachi sonal Sonam gupta Feb. 8, 2021
-1
call girls service Mumbai Callgirlmumbai Feb. 8, 2021
-1
call girls service Callgirlmumbai Feb. 8, 2021
-1
Przegląd kasyn Unibet Tom Rassel Feb. 8, 2021
-1
Reversed Linked List for data science kiransam Feb. 10, 2021
-1
https://nytimes-spellingbee.com/ SpellingBee889 Feb. 11, 2021
-1
Dubai Escorts Escorts Feb. 17, 2021
-1
Fildena Jaime_Corbett Feb. 19, 2021
-1
how to make my facebook private Chime Direct Deposit Feb. 20, 2021
-1
Make your Experience Unforgettable With Udaipur Escorts Top Class Genuine Escorts Service Provider in Udaipur Feb. 23, 2021
-1
Kamagra 100 Jaime_Corbett Feb. 25, 2021
-1
escorts service in guwahati payalarora Feb. 26, 2021
-1
What is ADHD | Treatment | Occur and Cause. Davidcastle Feb. 27, 2021
-1
IIOT and Several Different Industrial Automation Application elizagracee March 2, 2021
-1
ventura escape rooms escaperoom March 6, 2021
-1
Assignment, Essay, and Dissertation Writing Services in Singapore Matthew Brick March 9, 2021
-1
Learn easy methods to fix Cash app won't let me send money issue: James Thomas March 10, 2021
-1
Issue in send button a worsening while Apple Pay to Cash App? Discover uphold. James Thomas March 10, 2021
-1
How to get money off Cash app without card to make it safe? James Thomas March 10, 2021
-1
find the best software and services chandru ravi March 10, 2021
-1
Buy cenforce 200 online with the best price Jaime_Corbett March 10, 2021
-1
Buy All Pills Online | Tramadol 50mg, Adderall | Ambien 10mg Order Medicine Online | Overnight Shipping | Cheap & Affordable ambien10mg March 11, 2021
-1
Spa and all type of Services kajal varma March 12, 2021
-1
For inline math australiaescortshuba March 15, 2021
-1
Careprost | To Grow Thicker Eyelashes Jaime_Corbett March 15, 2021
-1
Learn About How To Contact The Cash App To Receive a Cash App refund? will smith March 16, 2021
-1
Connect to cash app customer service easily: will smith March 16, 2021
-1
Modafinil & Armodafinil Tablets [$25 OFF] - Uses, Side Effects, Dosage johnhood March 16, 2021
-1
How easy is it to wind up followers on Instagram? Arthur_Begay March 16, 2021
-1
Buy ED Medicines from United Medicines gainth March 17, 2021
-1
Buy ED Medicines from Genericmedsupply gainth March 17, 2021
-1
New suggestion down town decentwallart March 22, 2021
-1
React Vs Angular: A Battle Between Two surbhinahta March 24, 2021
-1
App Development Company Canada Julia Johnson March 24, 2021
-1
Vilitra 60: A Medicine That Worked Wonders For ED Jaime_Corbett March 24, 2021
-1
Buy ED Medicines jimmyshawn March 25, 2021
-1
Use Careprost For Eye Problem Jaime_Corbett March 26, 2021
-1
Mod ets2 indonesia Mod ets2 indonesia March 28, 2021
-1
Can I Trust Justfly? James Williams March 30, 2021
-1
Pain Relief Products At Affordable Price In USA kevinshaw March 30, 2021
-1
Assignment Writing Services BartOlom March 30, 2021
-1
Buy ED Medicines at United Medicines gainth March 30, 2021
-1
Buy ED Medicines at United Medicines gainth March 30, 2021
-1
How To Change Settings If Cash App Won't Let Me Send Money? James Thomas April 1, 2021
-1
Tips to transfer money from Apple pay to cash app. James Thomas April 1, 2021
-1
How to get money off cash app without card. James Thomas April 1, 2021
-1
Clickpharma Offers Tadacip 10mg Pills At Cheap Price Surgie Morte April 1, 2021
-1
Clickpharma Offers Tadacip 10mg Pills At Cheap Price Surgie Morte April 1, 2021
-1
Safest Place On The Internet To Buy Filitra Online Monica Manasia April 2, 2021
-1
Order Waklert Online And Get Bonus Pills Free Raquel April 5, 2021
-1
Buy online wooden furniture stool in Churu, India. servicewale April 6, 2021
-1
What's the Objective of a Cause-and-Effect Essay? Sylvia99 April 6, 2021
-1
Rely On Pharmaexpressrx To Get Modvigil Reviews Arthuro Oken April 6, 2021
-1
Explore tips for How to unblock people on Facebook: Daisy38456 April 7, 2021
-1
React Native best pick for your business 2021: Domaincer April 7, 2021
-1
The largest b2b portal of suppliers and manufacturers. servicewale April 8, 2021
-1
Buy Modvigil Pills From A Reliable Online Pharmacy Alicia Wikson April 8, 2021

Accepted problems

Problem Suggested By Accept Date
+2
Root Mean Square Deviation Guillaume Collet Dec. 5, 2012
+7
Distance between atoms Guillaume Collet Dec. 5, 2012
+5
Genome Assembly with Perfect Coverage and Repeats Rayan Nov. 26, 2012