Complementing a Strand of DNA solved by 1233

April 17, 2013, 5:54 p.m. by Rosalind Team

Topics: Bioinformatics Tools, Sequence Analysis

The Second Strand

Figure 1. Base pairing across the two strands of DNA.
Figure 2. The double helix of DNA on the molecular scale.

Recall Watson and Crick's discovery of the following secondary structure for DNA that was introduced in “Counting DNA Nucleotides”:

  1. The DNA molecule is made up of two strands, running in opposite directions.
  2. Each base bonds to a base in the opposite strand. Adenine always bonds with thymine, and cytosine always bonds with guanine; the complement of a base is the base to which it always bonds; see Figure 1.
  3. The two strands are twisted together into a long spiral staircase structure called a double helix; see Figure 2.

Because genomic DNA is double-stranded, during sequence analysis we should examine both the given DNA string and its reverse complement.

A number of online tools exist for taking the reverse complement of a given DNA string. Like the Reverse Complement program listed below, the revseq program from the EMBOSS package also performs this function. It can be run online here.

Problem

Recall that in a DNA string $s$, 'A' and 'T' are complements of each other, as are 'C' and 'G'. Furthermore, the reverse complement of $s$ is the string $s^{\textrm{c}}$ formed by reversing the symbols of $s$ and then taking the complement of each symbol (e.g., the reverse complement of "GTCA" is "TGAC").

The Reverse Complement program from the SMS 2 package can be run online here.

Given: A collection of $n$ ($n \leq 10$) DNA strings.

Return: The number of given strings that match their reverse complements.

Sample Dataset

>Rosalind_64
ATAT
>Rosalind_48
GCATA

Sample Output

1

Programming Shortcut

BioPython can also be used to take the reverse complement of a DNA string locally. Specifically, the complement() and reverse_complement() functions are suitable for this problem. These methods are associated with the Seq object.

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> my_seq = Seq("GATCGATGGGCCTATATAGGATCGAAAATCGC", IUPAC.unambiguous_dna)
>>> my_seq
Seq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA())
>>> my_seq.complement()
Seq('CTAGCTACCCGGATATATCCTAGCTTTTAGCG', IUPACUnambiguousDNA())
>>> my_seq.reverse_complement()
Seq('GCGATTTTCGATCCTATATAGGCCCATCGATC', IUPACUnambiguousDNA())

The IUPAC.unambiguous_dna() argument specifies that we are using the alphabet {A, C, G, T} and are not including the additional ambiguity symbols provided by IUPAC notation.

Please login to solve this problem.