Find the Most Frequent Words in a String solved by 1305

July 29, 2015, 1:11 a.m. by Rosalind Team

We say that Pattern is a most frequent k-mer in Text if it maximizes Count(Text, Pattern) among all k-mers. For example, "ACTAT" is a most frequent 5-mer in "ACAACTATGCATCACTATCGGGAACTATCCT", and "ATA" is a most frequent 3-mer of "CGATATATCCATAG".

Frequent Words Problem

Find the most frequent k-mers in a string.

Given: A DNA string Text and an integer k.

Return: All most frequent k-mers in Text (in any order).

Sample Dataset


Sample Output


Extra Datasets

Please login to solve this problem.