Problem	Suggested By	Suggest Date
0	SOBHA SENTOSA PANATHUR, EAST BANGALORE	Sobha Sentosa	Dec. 1, 2021
0	marble polishing	dubaiclean	Nov. 30, 2021
0	Call techies to get a solution for the random person sent me money on cash app issue	stuardboard	Nov. 30, 2021
0	Where Should You Invest In Blue World City?	Taj residencia Islamabad	Nov. 28, 2021
0	Best Hire Dedicated ASP .NET Developers, ASP .NET Development Solutions Company	ITConsultant Services	Nov. 28, 2021
0	Best Home Amplifier Under 100 Buying Guide	williampaullog	Nov. 26, 2021
0	Duchi® Official site I British Luxury Jewelry since 1800	kunshr	Nov. 24, 2021
0	free ost to pst converter software	romastella	Nov. 24, 2021
0	Why did a how to get random money on cash app?	stuardboard	Nov. 23, 2021
0	Mumbai Escorts | Mumbai Escorts Services | Escorts in Mumbai	Pooja Roy	Nov. 22, 2021
0	Hire vetted quality TypeScript developers within 48 Hours	OptymizeA	Nov. 22, 2021
0	How long does Google account recovery take?	ryan burgers	Nov. 18, 2021
0	What is Cash App Phone Number?	Square Cash Helps	Nov. 17, 2021
0	How to handle back end in python?	ghotojack	Nov. 16, 2021
0	Blog Tiền Tỷ	Blog Tiền Tỷ	Nov. 16, 2021
0	My blogging	charles	Nov. 15, 2021
0	NATURE'S NUTRITION APPLE CIDER VINEGAR, BENEFITS, USES, WORK, RESULTS & WHERE TO BUY?	ashmin67	Nov. 15, 2021
0	The Environmental problem for new born Baby	Smithwales	Nov. 15, 2021
0	Cash App - The easiest way to send/receive, spend, banking, and invest in 20212	ElizaKhan420	Nov. 12, 2021
0	do you like sex doll?	KevinMille	Nov. 9, 2021
0	A Rapid Introduction to Molecular Biology	johnwhite17	Nov. 7, 2021
0	love problem solution baba ji Canada	mk1694878	Nov. 6, 2021
0	Nova City Islamabad	Harvey	Nov. 4, 2021
0	https://www.facebook.com/Turbo-Heater-3-US-UK-Canada-102885148871692	healthvilla12	Nov. 3, 2021
0	I love sex dolls more than computers	KevinMille	Nov. 3, 2021
0	Turbo Heater 3	ashmin67	Nov. 3, 2021
0	How to Write an Academic Essay Abstract - A Guide	jessicawarnick	Nov. 1, 2021
0	Join the Amitabh Bachchan NFT release and place your bid	Balakrishnan	Nov. 1, 2021
0	What happens if negative balance on the Cash App?	smith johnson	Nov. 1, 2021
0	What is the way to activate cash app card?	smith johnson	Nov. 1, 2021
0	Are you finally ready to plunge into the world of cryptocurrencies?	tispisofye	Oct. 29, 2021
0	Roku Support	Roku1Support	Oct. 28, 2021
0	Seek help to know how Do I Contact The Cash App By Phone	jonsemily	Oct. 28, 2021
0	Know about What do you need to know about the cash app dispute ?	smith johnson	Oct. 27, 2021
0	Want to contact chime customer service through email?	stuardboard	Oct. 26, 2021
0	Call boy Jobs	dev.devnagri	Oct. 26, 2021
0	Know Your Core Web Vitals and Optimize them	alicebruno	Oct. 25, 2021
0	Love Vashikaran Specialist totally free vashikaran	mk1694878	Oct. 22, 2021
0	+91-7357771057 vashikaran without money	mk1694878	Oct. 22, 2021
0	Unitedmedicines | 100% Safe Medicines Online at Trusted Pharmacy in US	gainth	Oct. 21, 2021
0	Do you want to know the cash app refund policy?	alicebailey	Oct. 19, 2021
0	How to fix it if a cash app transfer failed?	miler david	Oct. 19, 2021
0	Goa Escorts Agency	Spider Goa	Oct. 19, 2021
0	Custom Boxes UK	markjackson	Oct. 19, 2021
0	Buy Cheapest Windows 11 Pro KEY	Buffcom net	Oct. 19, 2021
0	Most Important Reasons Why You Should Have Regular Pest Inspection	pimpmykitchen	Oct. 16, 2021
0	Buy Microsoft Office Professional Plus 2019 CD Key Global	Buffcom net	Oct. 15, 2021
0	Buy Microsoft Office Professional Plus 2019 CD Key Global	Buffcom net	Oct. 15, 2021
0	Need Help With Dissertation Writing Services UK	Oliver jake	Oct. 14, 2021
0	Reach professionals to know How to send money on the cash app without debit card.	Linda William	Oct. 14, 2021
0	How to Fix QuickBooks Error 15215?	masonolivia	Oct. 12, 2021
0	Professional Online Dating Services and Their Benefits If you have never tried using online dating services, then you have overlooked a very significant constituent part of the World Wide Web. Luckil	Martha E. Clark	Oct. 11, 2021
0	Running is Good	jerrysmith0	Oct. 10, 2021
0	love problem solution without money	mk1694878	Oct. 10, 2021
0	+91-7357771057 vashikaran without money	mk1694878	Oct. 10, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 10, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 10, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 10, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 10, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 10, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 10, 2021
0	free of cost vashikaran contact number	mk1694878	Oct. 10, 2021
0	free of cost vashikaran contact number	mk1694878	Oct. 10, 2021
0	Buy Adderall Online by Card and Fastest Shipping- USA Pain Pharma	myersj5841	Oct. 9, 2021
0	Call on the cash app helpline number to report a cash app dispute payment:	james joy	Oct. 8, 2021
0	Call on the cash app helpline number to report a cash app dispute payment:	james joy	Oct. 8, 2021
0	Top 9 cách đi backlink an toàn hiệu quả mà ai cũng muốn biết	Đào tạo seo traffic	Oct. 8, 2021
0	CÁCH TẠO BACKLINK HÀNG VẠN NGƯỜI MUỐN BIẾT	Đào tạo seo traffic	Oct. 8, 2021
0	Traffic là gì? Tại sao website lại cần có traffic?	Đào tạo seo traffic	Oct. 8, 2021
0	Cách Tăng Traffic Nhanh Nhất Hoàn Toàn Miễn Phí	Đào tạo seo traffic	Oct. 8, 2021
0	Want to contact the cash app help to activate the cash app card?	miler david	Oct. 7, 2021
0	Godrej Park Retreat | A Housing Retreat | Sarjapur Main Road | East Bangalore.	Godrej Park Retreat	Oct. 7, 2021
0	Thắc mắc An Trĩ Nam có hiệu quả như lời đồn?	pkdknguyentrai	Oct. 6, 2021
0	piciona.blogspot.com/2013/04/	robin smithsters	Oct. 5, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 5, 2021
0	+91-7357771057 Free Love Marriage Problem Solution Helpline Number	mk1694878	Oct. 5, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 5, 2021
0	free vashikaran mantra by photo	mk1694878	Oct. 5, 2021
0	free of cost vashikaran contact number	mk1694878	Oct. 5, 2021
0	Best Platform for fitness	manpreetrockerji	Oct. 4, 2021
0	Best Platform for fitness	manpreetrockerji	Oct. 4, 2021
0	How to Get Low Cost Linux Dedicated Server	Hostnet india	Oct. 4, 2021
0	+91-7297912841 free astrology call centre 24 hours	mk1694878	Oct. 3, 2021
0	+91-7357935089 Love Problem Solution in Canada	mk1694878	Oct. 3, 2021
0	how to do Dissertation Writing Help	Oliver jake	Oct. 1, 2021
0	Love Vashikaran Mantra	mk1694878	Oct. 1, 2021
0	Free Vashikaran Specialist Astrologer in Dubai	mk1694878	Oct. 1, 2021
0	totally free vashikaran	mk1694878	Oct. 1, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 1, 2021
0	free astrology call centre 24 hours	mk1694878	Oct. 1, 2021
0	Top những sàn chứng khoán uy tín nhất ở tại việt nam	TMM Co ltd	Sept. 30, 2021
0	Microsoft365.com/setup	Neil Nolan	Sept. 29, 2021
0	Start Your real-time chat app Venture With Appdupe’s Whatsapp Clone App	jackricher	Sept. 28, 2021
0	hi daraset	hicallgirl	Sept. 28, 2021
0	Mumbai Escort Service For Best Cost	sexyescortservice1	Sept. 27, 2021
0	Mumbai Escort Service For Best Cost	sexyescortservice1	Sept. 27, 2021
0	Mumbai Escort Service For Best Cost	sexyescortservice1	Sept. 27, 2021
0	Mumbai Escort Service For Best Cost	sexyescortservice1	Sept. 27, 2021
0	essay writing service	Beazy	Sept. 26, 2021
0	Gmail not receiving email	marieorpos	Sept. 23, 2021
0	How Do I Get My Money Back From Cash App To Your Wallet?	alicebailey	Sept. 21, 2021
0	STP for residential buildings	AmitS0007	Sept. 21, 2021
0	How To Check My Chime Balance If Facing Any Issue For The First Time?	Kim kardasia	Sept. 20, 2021
0	Cash app customer service facility-get solution right now:	Kim kardasia	Sept. 20, 2021
0	komarla brigade residency	Brigade Komarla Heights	Sept. 20, 2021
0	Bellsouth Net Email Login - Sign in	robert23	Sept. 19, 2021
0	VirtualDJ 9 Crack	Usman Hayat	Sept. 19, 2021
0	Can I get programming assignment help online?	David Wayne	Sept. 18, 2021
0	Lumion Pro Crack	Usman Hayat	Sept. 17, 2021
0	Free Software for Download	Usman Hayat	Sept. 17, 2021
0	VIP Escort in Greater Kailash Escorts	akku	Sept. 14, 2021
0	Buy Ambien 10mg Legally Online With Overnight Free Shipping | Shop From Buy Xanax Pill	mangolialexa	Sept. 14, 2021
0	put solutions for the problems	saysbad5	Sept. 12, 2021
0	AutoCAD Crack Version + License Key [Latest Version]	Ozum	Sept. 9, 2021
-1	Speedy Grade	kimberlykeller	Sept. 9, 2021
-1	Speedy Grade	kimberlykeller	Sept. 9, 2021
0	Why codeigniter is Good for Website Development ?	web development india	Sept. 7, 2021
-1	How does homework help you prepare for tests?	rosie4	Sept. 6, 2021
-1	best email marketing tool - wphostingmag	wphostingmag	Sept. 6, 2021
-1	BEST SERVICES FOR DRIVERS LICENSE ONLINE	andersonlarry597	Sept. 5, 2021
-1	How To Make Adult fanclub app development?	michalewilliam	Sept. 4, 2021
-1	Question 5 Solve the Pattern Matching Problem with Text = ATGACTTCGCTGTTACGCGC and Pattern = CGC to find all starting positions of Pattern in Text. Return the starting positions in increasing order	RawanAlhazaimeh	Sept. 4, 2021
-1	What is the most frequent 3-mer of TAAACGTGAGAGAAACGTGCTGATTACACTTGTTCGTGTGGTAT?	RawanAlhazaimeh	Sept. 4, 2021
-1	Compute Count(ACTGTACGATGATGTGTGTCAAAG, TGT)	RawanAlhazaimeh	Sept. 4, 2021
-1	Compute Count(ACTGTACGATGATGTGTGTCAAAG, TGT). 0 / 2 points	RawanAlhazaimeh	Sept. 4, 2021
-1	Buy lives at low prices for a limited time	manelnunez875	Sept. 2, 2021
-1	Now Make Your Account Robust Through Cash App Phone Number	kimberlyscott	Sept. 2, 2021
-1	Understand The Entire Scenario About How Long Does Cash App Take To Respond	kimberlyscott	Sept. 2, 2021
-1	Can you chat with Chime to resolve tech problems?	Kingmark	Aug. 25, 2021
-1	Robinhood customer service team-avail of solution service at once:	Kingmark	Aug. 25, 2021
-1	Can the sender cancel a Cash App payment when required?	Kingmark	Aug. 25, 2021
-1	à fournir la plus belle copie papier de votre mariage à chérir	goodrobe.fr	Aug. 25, 2021
-1	Buy Adderall Online Overnight No Rx in USA | Tramadolus.org	TramadolUS	Aug. 24, 2021
-1	Why is an eCommerce Website important for your Business!	KitoInfocom	Aug. 24, 2021
-1	vidalista 20	Tadarise 20 mg	Aug. 20, 2021
-1	vidalista 20	Tadarise 20 mg	Aug. 20, 2021
-1	vidalista 20	Tadarise 20 mg	Aug. 20, 2021
-1	Best IVF Centres in India with Low IVF Cost in India | Vinsfertility	Vinsfertility	Aug. 18, 2021
-1	mais restez fidèle à vous-même et cela se verra le jour de votre mariage	goodrobe.fr	Aug. 18, 2021
-1	How Hard It Is To Unlock Cash App Account If A New User?	stuardboard	Aug. 13, 2021
-1	Crucial factors of Cash app customer service features:	stuardboard	Aug. 13, 2021
-1	How to utilize the facility of Cash app customer service?	stuardboard	Aug. 13, 2021
-1	Best Astrologer in chennai online	Alka Ajith	Aug. 13, 2021
-1	Seek out impact of cash app customer service team:	stuardboard	Aug. 11, 2021
-1	Working strategy of cash app customer service team:	stuardboard	Aug. 11, 2021
-1	Attributes of cash app customer service team:	stuardboard	Aug. 11, 2021
-1	how to take care of sphynx kittens	janetlopez	Aug. 10, 2021
-1	how to take care of sphynx kittens	janetlopez	Aug. 10, 2021
-1	Business Setup in Dubai | Company Formation in UAE | Free Zone	Setup Business In Dubai	Aug. 10, 2021
-1	sphynx kittens for sale	janetlopez	Aug. 10, 2021

Accepted problems

	Problem	Suggested By	Accept Date
+2	Root Mean Square Deviation	Guillaume Collet	Dec. 5, 2012
+7	Distance between atoms	Guillaume Collet	Dec. 5, 2012
+5	Genome Assembly with Perfect Coverage and Repeats	Rayan	Nov. 26, 2012