Suggested problems

Biological Motivation

BEST SEO Tools Group Buy #1 GROUP BUY SEO TOOLS PROVIDER. [SEO][1] Tools Group Buy - ???? Frozenfry (the only original website) #Biggest Discount – On all plans. Apply Coupon code SUMMER30 to get instat 30% Discount.

[1]: https://frozenfry.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21