Suggested problems

Cricut Maker Machine

April 15, 2022, 5:35 a.m. by Cricut04

Biological Motivation

The machine is quite useful for architecture as well as for project work. Today, you will learn the setup process, i.e., Creating the Cricut Id, downloading and installing the Cricut machine, and setting up the machine physically. So let's start it.

https://win-cricut.com/setup/ https://mk-cricut.com/setup/ https://e-cricut.com/setup https://cricutsetupwindows.com/ https://crcricut.com/ https://down-cricut.com/setup/ https://steupcricut.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21