Suggested problems

Biological Motivation

Đá gà cựa dao Philippines mới nhất Đá gà cựa dao PhiLippines là thể thao đá gà phổ biến mới nhất hiện nay, bắt nguồn từ những đấu trường , chiến trường gà ở Campuchia và Philippin khu vực Đông Nam Á.

Các anh em Việt Nam yêu thích đá gà cựa dao PhiLippines vì cực kỳ mãn nhãn sự kịch tính, thu hút khốc liệt và hấp dẫn trong từng giây phút , sự táo bạo của các chiến kê trong trận thi đấu diễn ra.

Nguồn : https://dagabinhluan.com/da-ga-cua-dao/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21