Suggested problems

First Night Room Decoration In Delhi | Mumbai

April 13, 2022, 11:12 a.m. by Hotel Room Decoration For Birthday

Biological Motivation

First Night Room Decoration

Every wedding is special and so is the decoration for the first night as it is the first impression on your partner. Citing the competency over the social media it is also very important to make the [first night room decoration][1] look outstanding. After all, taking selfies and posting them online is a must thing amongst everyone these days.

At Muraad decorations you can get numerous excellent first night decoration ideas. Also if you are looking for first night surprise decoration ideas then we can be a great help. Earlier things were different but now taking care of each other's liking is not a big deal hence planning a surprise first nights etup could be a great idea to impress your spouse. Making clients happy in Delhi and Mumbai, Muraad will be glad to be a part of your wedding celebration in any way.

Take a look at the themes we have to offer:

Flower First Night Bed Decoration: It has been followed since ages that a nicely decorated bed is a must on your first night. However, with the time now the first night bed decoration has changed a lot. One thing that still is common is the flower. Muraad also offers you amazing flower first night bed decoration ideas to make your first night more romantic. You can suggest your choice of flower and we assure to bring out the best decorations from it.

First Night Decoration With Candles: Another very popular prop these days being used for first night decoration is- Candle. Yes, these lovely designer candles can enhance the mood just in seconds. Also, a room beautifully lit could be a great place to click pictures hence making you a hit on social media.

Hope this article gives you an insight of what Muraad has to offer its clients. Also, we happily welcome ideas by clients and work hard in their implementation.

Contact Us:

A1-48, Vijay Enclave, New Delhi – 110045 Mob - 9650487492

[1]: https://muraaddecorations.com/first-night-surprise-decoration/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21