Suggested problems

Gemstone Beads Wholesale Online Supplier from Jaipur India

April 12, 2022, 10:02 a.m. by Gems Biz

Biological Motivation

Buy world famous [wholesale natural gemstone beads][1] online that are manufactured in Jaipur, India, the globally reputed hub for stone beads for jewelry making.

[1]: https://www.gemsbiz.com/beads

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21