Suggested problems

free ost to pst converter software

April 11, 2022, 8:37 a.m. by ost to pst

Biological Motivation

Stella [Microsoft ost to pst converter software][1] is the best ost file converter software to convert all ost mailbox items in to pst file. this software is convert all Microsoft ost file data like emails items, contacts items, calendars items, notes items, task items and many other items in to office 365 account. This software is capable to convert all 32bit and 64bit ost mailbox items in to pst file. for more info visit this link https://www.stelladatarecovery.com/ost-to-pst-recovery.html

...

[1]: https://www.stelladatarecovery.com/ost-to-pst-recovery.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21