Suggested problems

Does Cash App Routing Number Help In Enabling The Direct Deposit?

April 11, 2022, 6:32 a.m. by alinaluice

Biological Motivation

To enable the direct deposit feature on your Cash App account, you will need to simply find out [Cash App Routing Number][1], Cash App bank name, and Cash App account number. In case of any hassle you face while doing the same, you should take help from the Cash App specialists right now.

[Cash App Routing Number]: https://www.cash-app-helps.com/blog/how-to-change-routing-number-on-cash-app/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21