Suggested problems

A Rapid Introduction to Molecular Biology

If you are looking to download mod apks safe and securely. Then you should really visit this website called apkkernal.com. The have all your favourite apps and game. You can even request for the app you want to be added there. By far the best mod for me is [capcut mod apk latest version][1] ...

[1]: https://apkkernal.com/capcut-mod-apk/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21