Suggested problems

Price | Tata One Bangalore | 1, 2 and 3 BHK | Devanahalli

April 8, 2022, 10:21 a.m. by Tata One Bangalore

Biological Motivation

Tata One Bangalore Luxury, open for all residential property in Devanahalli, is one of the prime locations in Bangalore city. The launch price of the property will be attractive and very competitive areas. https://www.tataonebangalore.org.in/ ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21