Suggested problems

Walmart Clone! The best ecommerce script in the market.

April 8, 2022, 7:42 a.m. by BuzzNewlight

Biological Motivation

Walmart has the best features in the market that allows you to manage all your vendors and compete with your competitors. It has an easy system that allows you to make payments and keep track of all the payment details. If you want to run a global business it is the best option in the market.

Kickstart your profitable eCommerce business with Walmart Clone Script. Which is built with attractive designs and alluring features.

https://www.trioangle.com/walmart-clone/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21