Suggested problems

Cicinia hat seine Wurzeln in stilvollen Brautjungfernkleidern mekleid.de

April 8, 2022, 7:08 a.m. by mekleid

Biological Motivation

Cicinia hat seine Wurzeln in stilvollen Brautjungfernkleidern. Wir widmen uns dem Design von mehr als 200 Stilen von Brautjungfernkleidern, die Ihre Erwartungen bei weitem übertreffen. Von klassischen Styles wie Knielänge, Hofschleppe und V-Ausschnitt bis hin zu modischen Styles wie Neckholder, 3/4-Ärmel und mehr. Wir bemühen uns, einen exzellenten Kundenservice zu bieten, von Ihrer Anfrage bis nach dem Kauf. Wir möchten Ihren großen Tag noch schöner machen!

​ Um diese Brautjungfernkleider zu kaufen, besuchen Sie Cicinia online für Käufer aus den USA und aus Großbritannien. Cicinia entwirft stilvolle Brautjungfernkleider zu erschwinglichen Preisen in einer Reihe von Farben und Stoffen, die garantiert perfekt zu Ihrer Hochzeit passen. http://www.mekleid.de

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21