April 7, 2022, 9:41 a.m. by BuzzNewlight
Biological Motivation
..eCommerce has been the face of the new business world in recent times. it has made people think and behave differently but it didnt stop there because it also made people purchase products without having physical contact. The eCommerce script also helps you run your own business and manage multi-vendors easily. You can also track data to make new decisions at the right time to gain more profit.
On the online platform, the best eCommerce script will lucrative your business. We Trioangle dispense the best script with the technical support to pioneer the market with all the required features. for more details: https://www.trioangle.com/ecommerce-app-development/ Whatsapp number: +91 6379630152.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
