Suggested problems

15 Ingenious Ways You Can Do With Oros CBD Gummies.

April 7, 2022, 8:33 a.m. by OrosCBD

Biological Motivation

Oros CBD Gummies:- is a low sugar diet that makes the body produce CBD Gummies as a wellspring of energy. This diet has numerous medical advantages including weight reduction, lower pulse and raised temperament. ORDER NOW:-https://marylandreporter.com/2022/04/06/oros-cbd-gummies-reviews-scam-exposed-2022-real-benefits-or-negative-side-effects-where-to-buy/ https://wireusanews.blogspot.com/2022/04/15-various-ways-to-do-oros-cbd-gummies.html https://sites.google.com/view/oros-cbd-gummies1/home https://www.facebook.com/Oros-CBD-Gummies-105314512150393 https://groups.google.com/g/oroscbdgummiesprice https://www.facebook.com/oroscbdgummies.official/ https://www.mynewsdesk.com/healthyworldstock/pressreleases/eagle-hemp-cbd-gummies-reviews-2022-it-has-natural-and-potential-options-to-eliminate-chronic-pain-3162437 https://www.mynewsdesk.com/healthyworldstock/pressreleases/next-plant-cbd-gummies-reviews-25mg-per-gummy-full-spectrum-thc-free-how-it-works-3156322 https://www.mynewsdesk.com/healthyworldstock/pressreleases/natures-only-cbd-gummies-reviews-reduce-pain-or-stress-quit-smoking-help-with-natural-ingredients-3155755 https://ipsnews.net/business/2022/03/27/smilz-cbd-gummies-reviews-scam-consumer-reports-price-for-sale-where-to-buy/ https://www.fingerlakes1.com/2022/03/26/mayim-bialik-cbd-gummies-official-website-reviews-usa-smilz-cbd-gummies-mayim-scam-or-trusted/ https://ipsnews.net/business/2022/03/19/calmwave-cbd-gummies-canada-reviews-trusted-or-fake-scam-alert-2022/ https://www.sfweekly.com/sponsored/is-smilz-cbd-gummies-mayim-bialik-scam-reviews-antonio-brown-shark-tank-side-effects-are-it-works-or-trusted/ https://ipsnews.net/business/2022/03/14/dementia-cbd-gummies-warning-dementia-patients-best-cbd-gummy-award-is-it-scam-or-trusted/ https://ipsnews.net/business/2022/03/14/jeopardy-cbd-gummies-scam-reviews-2022-read-benefits-side-effects-before-buy/ https://ipsnews.net/business/2022/03/03/uly-cbd-gummies-reviews-fake-or-trusted-100-effective-pain-relief-cost-read-report-before-buy/ https://ipsnews.net/business/2022/03/03/clinical-cbd-gummies-reviews-shocking-scam-2022-what-to-know-before-using-read-more/ https://ipsnews.net/business/2022/02/09/nordic-cbd-gummies-australia-real-reviews-uk-ca-pain-relief-cbd-nordic-does-it-work-or-not/ https://ipsnews.net/business/2022/03/27/smilz-cbd-gummies-reviews-scam-consumer-reports-price-for-sale-where-to-buy/ https://www.facebook.com/mayim.bialik.cbd/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21