Suggested problems

gartic phone

April 6, 2022, 7:12 a.m. by sunny123

Biological Motivation

ovo game is a fast-paced platformer in which you must complete each level using improvised and precise parkour skills. The obstacles will become increasingly intricate, requiring you to make numerous jumps, slides, and drops to overcome them. The OvO Game is a unique and interesting game that combines fun and tough mental and physical challenge. It's ideal for folks who have trouble playing games since it promotes brain health, lowers stress, and boosts memory gartic phone Game is a fun educational game that teaches kids how to draw. It's so easy to use, that even young children can play it. Kids start the game by drawing a picture of their favorite character on the screen, like a superhero or princess.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21