Suggested problems

The best epic, long-playing PC games will consume days of your life.

April 4, 2022, 3:01 a.m. by selenaoh123

Biological Motivation

One of the best games to play when you're bored is subway surfers. You'll be able to hop on trains, avoid obstacles and collect coins while riding the trains. This game can get really challenging so you might want to try it a few times before playing it for real! It's like a puzzle that's fun to solve. To help new players find their way around the game, read on for tips on how to complete this challenging game in three minutes. The Shell Shockers Game is a unique game that combines mental and physical challenges in an entertaining and challenging manner. It's ideal for folks who have trouble playing games. The game promotes brain health, lowers stress, and boosts memory. It's a fun game to play with the whole family or with friends, and it's a great way to pass the time while watching TV!

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21