Suggested problems

Đọc sách đúng cách

April 2, 2022, 9:24 a.m. by Vachnghethuat_vn

Biological Motivation

Sách lục mục phản ánh dàn ý chung và đơn giản của nội dung, đôi khi phản ánh cả dàn ý lo-gic của nó. Giúp bạn giải đáp được câu hỏi: “Cuốn sách có những nội dung gì, theo thứ tự nào?”. Sau khi có được thông tin về nội dung và cuốn sách đích, bạn sẽ trực tiếp tìm hiểu về nội dung bằng cách đọc qua một số đoạn, phát hiện các đoạn thú, có giá trị. Nhờ đọc qua một vài đoạn như vậy, những nhận định về nội dung cuốn sách sẽ dần dần được xác định chính xác, tạo điều kiện cho các bước đọc sau. Ngoài ra, tư thế đọc đúng cách vừa thoải mái vừa không gây hại cho mắt, các cột sống. Chúng ta nên sử dụng các loại [bàn làm việc gỗ][1], nhựa,... và ghế có tựa. Khi đọc sách bạn cũng không nên đọc quá lâu, khoảng 25 phút bạn nên nghỉ giải lao một lần , điều này sẽ giúp tinh thần của bạn sảng khoái và thư giãn hơn trước khi tải thêm kiến ​​thức. Chỉ cần đứng dụng lên và đi giãn thư trong vòng 5 phút để làm đôi mắt thấy khỏe hơn và tăng lượng giúp lưu thông tin để bạn nhanh hơn, sau đó bạn có thể ngồi xuống và đọc tiếp. [1]: http://vachnghethuat.com/tai-sao-nen-su-dung-vach-ngan-phong-pvc/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21