April 1, 2022, 11 a.m. by oliviasmith45
Biological Motivation
Buy All types of medicine at best price with discount + free pills for sale, free & fast shipping , fast + free + cash on delivery (cod), overnight delivery, easy returns, 24 by 7 customer care service, quick cash back guarantee, 100 % safe medication in California online @Unitedmedicines.com.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21