Suggested problems

Ten Reliable Sources To Learn About Eagle Hemp CBD Gummies.

March 30, 2022, 8:46 a.m. by EagleHempCBDGummiestry

Biological Motivation

Eagle Hemp CBD Gummies:-Assuming you are likewise among those individuals who become restless abruptly or experience contracting torment across body, then, at that point, it is an ideal opportunity to zero in on utilizing CBD chewy candies like Eagle Hemp CBD Gummies. ORDER NOW:-https://www.mynewsdesk.com/healthyworldstock/pressreleases/eagle-hemp-cbd-gummies-reviews-2022-it-has-natural-and-potential-options-to-eliminate-chronic-pain-3162437

https://www.mynewsdesk.com/healthyworldstock/pressreleases/next-plant-cbd-gummies-reviews-25mg-per-gummy-full-spectrum-thc-free-how-it-works-3156322

https://www.mynewsdesk.com/healthyworldstock/pressreleases/natures-only-cbd-gummies-reviews-reduce-pain-or-stress-quit-smoking-help-with-natural-ingredients-3155755

https://www.facebook.com/bulk.extreme

https://www.mynewsdesk.com/healthyworldstock/pressreleases/eagle-hemp-cbd-gummies-reviews-2022-it-has-natural-and-potential-options-to-eliminate-chronic-pain-3162437 https://www.fingerlakes1.com/2022/03/26/mayim-bialik-cbd-gummies-official-website-reviews-usa-smilz-cbd-gummies-mayim-scam-or-trusted/

https://ipsnews.net/business/2022/03/19/calmwave-cbd-gummies-canada-reviews-trusted-or-fake-scam-alert-2022/

https://www.sfweekly.com/sponsored/is-smilz-cbd-gummies-mayim-bialik-scam-reviews-antonio-brown-shark-tank-side-effects-are-it-works-or-trusted/

https://ipsnews.net/business/2022/03/14/dementia-cbd-gummies-warning-dementia-patients-best-cbd-gummy-award-is-it-scam-or-trusted/

https://ipsnews.net/business/2022/03/14/jeopardy-cbd-gummies-scam-reviews-2022-read-benefits-side-effects-before-buy/

https://ipsnews.net/business/2022/03/03/uly-cbd-gummies-reviews-fake-or-trusted-100-effective-pain-relief-cost-read-report-before-buy/

https://ipsnews.net/business/2022/03/03/clinical-cbd-gummies-reviews-shocking-scam-2022-what-to-know-before-using-read-more/

https://ipsnews.net/business/2022/02/09/nordic-cbd-gummies-australia-real-reviews-uk-ca-pain-relief-cbd-nordic-does-it-work-or-not/

https://ipsnews.net/business/2022/03/27/smilz-cbd-gummies-reviews-scam-consumer-reports-price-for-sale-where-to-buy/

https://www.facebook.com/mayim.bialik.cbd/

https://www.facebook.com/Eaglehempcbd/

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21