Suggested problems

Lợi ích của British Columbia PNP - Chương trình nhập cư Express Entry

March 30, 2022, 2:33 a.m. by New Life Immigration

Biological Motivation

Một công việc mới cho bản thân nhưng cũng có thể nhập cư Canada cho cả gia đình, đưa họ đến một chân trời mới, nơi có chất lượng cuộc sống tốt hơn. Lý do nhiều người chọn định cư Canada theo chương trình BC PNP • Thời gian hoàn thành thủ tục nhanh chóng, bạn chỉ mất khoảng 12-15 tháng để trở thành thường trú nhân Canada. • Có nhiều công việc với mức lương hấp dẫn (theo các mã ngành NOC 0, A, B) mà bạn có thể lựa chọn tùy theo nhu cầu và kinh nghiệm của mình. Thu nhập bình quân hàng năm có thể dao động trên dưới 1 tỷ đồng / năm. • Cơ hội làm việc và định cư tại nhiều thành phố lớn của Canada như Richmond, Vancouver, Burnaby, Victoria. Chế độ việc làm, lương thưởng tốt, phù hợp với năng lực của từng người. • Cả gia đình nhận được thẻ xanh cùng một lúc. • Mức chi phí ở BC không quá cao.

Quy trình xử lý hồ sơ tại New Life Immigration Bước 1: Thẩm định hồ sơ Bước 2: Chuẩn bị hồ sơ Bước 3: Mở hồ sơ Express Entry Bước 4: Nhận lời mời làm việc và LMIA Bước 5: Nộp hồ sơ tài trợ tỉnh bang Bước 6: Nộp hồ sơ xin thường trú dân Bước 7: Nhận giấy xác nhận thường trú dân Bước 8: Nhận Thẻ thường trú nhân

Công ty: New Life Immigration Điện thoại: 0909160530 Địa chỉ: 39 - 40L Đường 11 (Miếu Nổi), Phường 3, Quận Bình Thạnh, Thành phố Hồ Chí Minh, Việt Nam Website: https://newlifeimmigration.vn/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21