Suggested problems

Annapurna Circuit Trekking

March 27, 2022, 4:33 a.m. by Himalayan Frozen Adventure

Biological Motivation

[Annapurna Circuit Trek][1] is a classic route in Nepal which is high passes trail in the world as well as you will explore the surrounding Himalayan ranges, magical landscapes, amazing icefalls, glaciers lakes, and traditional culture of the local community.

You can encounter a gamut of topological variations in the [Annapurna Circuit Trekking and Tilicho Lake][2] within the duration of a normal trek. Aptly titled Nepal's classic trek the Annapurna Trek displays divergent landscapes ranging from the sub-tropical region to the alpine region and the semi-desert region.

Thorong La Pass is the highest and best viewpoint to this trek which lies 5,436 meters above sea level, it passes through oak and pine forests and eventually emerging into high altitude desert country at Manang (3597 m.) and above. As well as pass takes Marsyangdi towards the Kali Gandaki valley and descends through Muktinath’s village.

If you have more days then you can discover the [Annapurna circuit trek][3] with tilicho lake, Witness this massif and its many towering peaks that include Annapurna I, II, III, IV, the Dhaulagiri (8167m), Machchhapuchhre (Fish Tail), Annapurna South and Manaslu.

...

[1]: https://www.himalayanfrozen.com/annapurna-circuit-trek [2]: https://www.himalayanfrozen.com/annapurna-circuit-trek-with-tilicho-lake [3]: https://www.himalayanfrozen.com/annapurna-circuit-trek

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21