Suggested problems

Những sai lầm khi thiết kế shop quần áo khiến bạn “mất khách”

March 25, 2022, 2:35 p.m. by HPDecor

Biological Motivation

Có không ít shop quần áo rơi vào tình trạng sản phẩm thời trang đa dạng, chất lượng đẹp, giá bình dân. Thế nhưng lại vẫn không có nhiều khách! Câu hỏi đặt ra ở đây là tại sao lại như vậy?

Có một sự thật là khi mở shop quần áo, bên cạnh mẫu mã, chất lượng sản phẩm thì một shop quần áo có “ăn khách” hay không sẽ phụ thuộc rất lớn vào việc thiết kế cửa hàng. Thiết kế không phù hợp, không thuận tiện, trang trí không hiện đại, thời trang thì chắc chắn việc thu hút khách hàng là rất khó.

Chính vì vậy, bạn nên cập nhật xu hướng mới để có thể thay đổi và thiết kế shop quần áo phù hợp hơn.

Tham khảo ngay một số phong cách thiết kế Shop quần áo thời trang Hot hit nhất hiện nay: https://hpdecor.vn/thiet-ke-shop-quan-ao

hpdecor, #thietkeshophpdecor, #thietkeshopthoitranghpdecor, #thietkeshopthoitrang, #thietkeshopquanao,

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21