March 25, 2022, 6:39 a.m. by ryanazim
Biological Motivation
Batteries are one of the most important part of vape devices. The battery heats the coil that turns the e-liquid into vapours. A vape device is useless without a battery. Batteries come in different sizes and shapes, and it depends on the vape device which one to use.
Disposable vapes like Elf bars disposable and Geek bars disposable have in-built batteries that are non-rechargeable and can not be replaced either. Only a few disposable vapes have the additional feature of recharging the battery. Some rechargeable/reusable vapes have external vape batteries.
In this blog will help you to understand the importance of external vape batteries. There are many advantages of using external vape batteries. Some of them are listed below:
● Extends life of vape device ● External charging ● Availability of spare batteries ● More choice over batteries
Extension of Vape Device’s Life:
External vape batteries extend the life of your vape kit. You do not need to change your entire vape device when the battery runs out. In the case of people using disposable vapes, it might cause a slight inconvenience as in-built batteries can neither be recharged nor replaced.
Advanced vape kits are available for those who wish to use their vape device for a long time. You can change your vape battery after it becomes inefficient. Instead of buying a new vape kit everytime, replacing the battery saves you a lot of money as batteries are cheap.
External Charging: External vape batteries can be charged with the help of a cable provided with the vape kit. Some advanced vapes can be charged with phone charging cables. But you should be cautious that more power than needed is not used.
You should always charge your vape kit by connecting it to laptops, game consoles or TV ports. The battery should never be left for charging overnight. Overcharging decreases the life of the battery, and it might even explode. While charging your vape kit a bit of caution is required, but it’s not a big hassle. You can easily charge it at low power.
Spare Batteries: You can always keep a spare battery with you. These batteries can come in handy if your vape device needs recharging and the charging facility is not available. You can even insert an already charged battery while the other one gets charged.
You will not have to wait for your device to charge if you use a spare battery. While one battery gets charged, you can keep enjoying your vaping without waiting. This is an excellent feature for regular vape users.
Choice While Choosing Batteries: External vape batteries have a lot of varieties. They come in different shapes and sizes. You can choose one according to the type of coil you use or the e-liquid composition that you intend to use.
As some people who prefer quality over the battery’s life, they can choose any high-quality battery. Some people prefer a battery with a long life span. You can have a choice over battery instead of being stuck with the built-in battery of your vape kit.
Some Tips For Using Batteries Efficiently: If you do not pay attention to a few general things, you might end up ruining your battery. Here are some general things you should be aware of:
● The battery should be kept at room temperature. It will be damaged if kept at higher or lower temperatures. ● The battery should not be kept in a pocket with coins or keys. Rubbing of unprotected batteries can cause a spark and lead to a fire. ● You should use a battery case for spare batteries. Unprotected batteries can lead to accidents. ● Batteries of some vapes cannot handle the voltage more than 1amp so those batteries should not be charged on more than 1amp voltage. ● Vape battery should never be charged for more than 3 hours. ● You should not use damaged batteries and use the right battery for your vape kit.
External vape batteries have many benefits. This feature of replaceable batteries has made the vaping experience more convenient and enjoyable for the vapers. Using in-built batteries such as in disposable vapes like Elux legend 3500 puffs is also great as it saves you from the hassle of recharging and replacing batteries. But many people find external vape batteries more suitable. It gives them a free choice over their device.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21