Suggested problems

Try the all new amazon clone and manage your own marketplace

March 25, 2022, 6:07 a.m. by BuzzNewlight

Biological Motivation

Amazon clone is considered to be the best online marketplace management system. You can easily add and manage product performance and develpe new starategies to overcome the challenges with advanced features built in the clone.

Amazon clone is the Trioangle's best eCommerce script with top-end features to help the entrepreneurs to have a profitable frame.

for more details: https://www.trioangle.com/amazon-clone/ Whatsapp number: +91 6379630152

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21