Suggested problems

Which type of fabric dresses for girl online

March 24, 2022, 10:48 a.m. by whitedahlia

Biological Motivation

Get latest fashion and trendy dresses for girls. We white dahlia presenting you the best dresses for girls. We have wide range of beautiful dresses, designer dresses. Just order [dresses for girls online][1] with our website. Choose your favorite dress and make an online order. We delivered your dress as soon as. Just visit our website and order.

[1]: https://whitedahlia.co.in/collections/dresses

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21