Suggested problems

Vaishanavi Life Plots | Plotted development Company in Devahalli

March 24, 2022, 6:47 a.m. by vaishnavilifesplots

Vaishnavi Life Plots

[Vaishnavi Life Plots][1] is Plotted Development Company in Devanhalli area, Vaishnavi Life Is Launched By Vaishnavi Groups. [Vaishnavi Life Master plan][2] is Work Industrial and Residential Projects. [Vaishnavi Life Prices][3] is Welcome to Each any Every Buyers

...

[1]: https://www.vaishnavilife.net.in/ [2]: https://www.scoop.it/topic/real-estate-by-vaishnavi-life-plots [3]: https://youtu.be/CUhjZe3FyUI

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21