Suggested problems

seo optimization company

March 22, 2022, 3:54 a.m. by koritry

Biological Motivation

[seo optimization company][1]

[1]: https://www.freetopblogger.com/seo

A man was going to the house of some rich person. As he went along the road, he saw a box of good apples at the side of the road. He said, "I do not want to eat those apples; for the rich man will give me much food; he will give me very nice food to eat." Then he took the apples and threw them away into the dust. He went on and came to a river. The river had become very big; so he could not go over it. He waited for some time; then he said, "I cannot go to the rich man's house today, for I cannot get over the river." He began to go home. He had eaten no food that day. He began to want food. He came to the apples, and he was glad to take them out of the dust and eat them.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21