Suggested problems

Essay Help

March 20, 2022, 6:29 a.m. by noahwalker6

Biological Motivation

Hii, students are facing problems in writing essay. Let me tell you something .EssayCorp supports learners in finishing their essays according to the university guidelines. We offer the best assignment writing services at very reasonable price allocations. Our writers draft the projects without plagiarism and errors. EssayCorp delivers the writing tasks before the given time frame to avoid late submission. For further details concerning our [Essay Help][1], kindly mail us at contact@essaycorp.com.

[1]: https://www.essaycorp.com/services/essay-help

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21