Suggested problems

Annapurna Trekking in Nepal

March 20, 2022, 3:34 a.m. by Himalayan Frozen Adventure

Biological Motivation

The major famous route [Annapurna Base Camp Trek][1] is an amazing destination in Himalayan Nepal which take you to the foot of Mount Annapurna, it's our special itinerary for those who are short on time and still want to do the Annapurna Sanctuary trek, Annapurna Base Camp has an alluring and tranquil environment along with its beautiful northern settlements, the Annapurna massif is a 55 km long-range consists of peaks up to 8000mts.

This Annapurna Base Camp Trekking is attractive with the magical landscapes, wonderful natural, delightful culture, and surrounding views of Himalayan peaks with glaciers, the trek is a moderate and low epic adventure hike along with explorations vicinity the Annapurna valley, this trek takes the trekkers through the immensely beautiful trekking trails of the ABC, Trekking to the base camp of gigantic Mt. Annapurna is a blissful moment.

Annapurna Base Camp Trek provides to visit popular viewpoint [Poon Hill][2] which is 3,210 meters above sea level, if you choose to tackle the routes of Annapurna base Camp you will be choosing to walk along the lowland pastures, bamboo and rhododendron forest, alpine scrub and the culturally and artistically rich hillside villages will give you a life-changing experience.

The [ABC Trek][3] offers Mesmerizing views of majestic Himalayas including Mt. Macchapuchre, Mt. Hiunchuli, Annapurna South, Annapurna I, Annapurna III, Gangapurna, and others, throughout the Annapurna Region covers the major (Flora & Fauna ) special natural gifts like green eye nurturing pastures, singing rivers, green lush jungles, various landscapes, and natural hot springs.

[1]: https://www.himalayanfrozen.com/annapurna-base-camp-trek [2]: https://www.himalayanfrozen.com/ghorepani-poon-hill-trek [3]: https://www.himalayanfrozen.com/annapurna-base-camp-trek

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21