Suggested problems

Seo Companies Primelis

March 19, 2022, 10:32 a.m. by online promotion of business

Biological Motivation

[Seo Companies Primelis][1]

[1]: https://www.webdesigninghouse.com/enterprise-and-corporate-seo-services Best Seo Companies Primelis is Web Designing house. Our expertise will help you build brands and generate traffic, leads, and sales through your website.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21