Suggested problems

Dulux Paint Dealership

March 19, 2022, 10:30 a.m. by online promotion of business

Biological Motivation

[Dulux Paint Dealership][1]

[1]: https://www.asianpaintsdealerships.com/india/dulux-paints-dealership-distributorship-franchise.php

Asian Paints Dealership is Asian Paint Dealership is operating in 15 countries. Dulux Paint Dealership is the third largest country in the world. It headquarter is available in Mumbai. he significant ventures needed to begin a paint dealership business are to purchase paint inventory, retail shop on prime location, a mixing machine, shop interior, and a computer with a printer

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21