Suggested problems

Residential Plots & Land For Sale in Bangalore-Prestige Marigold

March 17, 2022, 9:38 a.m. by Prestige Marigold Plots

Prestige Marigold

Prestige Marigold has completed more than 240 projects and area over 134 million square feet, and currently has over 50 ongoing projects [https://www.youtube.com/channel/UCUr1u5--T5tpFSJYC3E-kxw/about][1] [https://twitter.com/MarigoldPlot][2] [https://www.instagram.com/prestigade_marigold/][3] [www.linkedin.com/in/prestige-marigold-villa][4] ...

[1]: https://www.youtube.com/channel/UCUr1u5--T5tpFSJYC3E-kxw/about [2]: https://twitter.com/MarigoldPlot [3]: https://www.instagram.com/prestigade_marigold/ [4]: http://www.linkedin.com/in/prestige-marigold-villa

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21