Suggested problems

How to get Luxurious Apartment in Sarajpur?

https://www.godrejsparkretreat.in/location.html the most expensive property listed in Sarjapur is 8 crore. 4 area in Sarjapur show an reality The average price in Sarjapur is around 4500 to 6300 INR per sq ft. the annual appreciation is estimated to be inflated by 4%. Connectivity plays a major role and access to social infrastructure and compare rates are the main reasons. ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21