March 15, 2022, 8:37 a.m. by din hickup
Biological Motivation
[Cash App Dispute][1] helps the users to get your money back to your account if your fund has been transferred to the wrong merchant. To understand how it works and what exactly the dispute procedure is, you have to contact the Cash App support representatives without wasting your time.
[1]: https://www.cash-app-helps.com/blog/cash-app-dispute-payment/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21