March 14, 2022, 1:59 p.m. by Angeline
Biological Motivation
The modern world gives birth to modern ideas and modern art forms. The current one is the algorithmically generative arts. No one expected it would turn out to be something really big when Larva Labs came up with CryptoPunks. But then we all know what it is now. So, generative arts are created by certain codes written on a smart contract. These codes mostly represent certain attributes that are supposed to be randomly assigned to a specific number of characters. All the conditions for the creation of the digital arts are on the code and are generated in a flash. Let’s say 10,000 unique digital arts can be created just like that. We all know how difficult and time-consuming it is to create 10,000 unique artworks in the traditional way. However, the algorithmically generated pixelated arts have opened a new gateway for the art industry. Create a platform for artists with ideas to generate their pixelated artworks instantly. https://www.appdupe.com/nft-studio
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
