Suggested problems

Biological Motivation

SMO builds up the compliance of customers, potential ones in prospective clients to improve the business. The techniques publicize the company over social media platforms. This helps you to create a lot of awareness about the brand and company in the huge social networking websites and allows you to explore the different market to foster your online brand as well as establishing the reputation of same. Best [social media optimization services India][1] will include different social media networks such as Pinterest, Google Plus, Facebook, Twitter and many more

[1]: https://www.serpwizard.com/smo-services-india/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21