Suggested problems

Indigo Paint Dealership

March 7, 2022, 11:33 a.m. by online promotion of business

Biological Motivation

The High Quality Paint Dealership is Indigo Paint Dealership. They provides you assistance and gives best service. If you want to start business in India, Asian Paints group is the holding company of Indigo Paint Dealership International. Asian Paints Dealership is cost effective. They provided the best margin & profit.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21