Suggested problems

Gift

March 6, 2022, 4:21 p.m. by Terra345

Biological Motivation

After all the difficult quarrels and conflicts that occur in my family, I always try to go for reconciliation. After all, I understand that no one will love me as much as my family. I even have a reason for this: to give a wonderful postcard with daffodils [https://boomf.com/collections/daffodil-mothers-day-cards][1] and thus give mom positive emotions after so many bad mls.

...

[1]: https://boomf.com/collections/daffodil-mothers-day-cards

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21