Suggested problems

What are the benefits of using gift cards?

March 6, 2022, 6:34 a.m. by accountswinn

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1. Using both digital and physical gift cards can offer a number of benefits, including:

Gift cards are convenient and easy to use.
They can serve as a good substitute form of payment if you prefer not to use your credit card or pay cash.
Gift cards are helpful for avoiding bank overdrafts and controlling your spending.
They are an excellent gift for holidays or other special occasions.

When it comes to buying gifts, gift cards from PrizeRebel offer an excellent alternative in case you have no idea what to get somebody, as they allow the recipient to choose what to buy themselves.[Accountswinn][1] ...

[1]: https://www.accountswinn.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21