March 6, 2022, 6:30 a.m. by accountswinn
Biological Motivation
Gift cards from most vendors come with a certain gift card expiration after the date of purchase. In addition, if the gift card hasn’t been used within 12 months after the purchase, fees for dormancy, inactivity, or service can be charged, reducing its value. For example, Amazon gift cards expire one year after the date of issuance, meaning that you would lose any unused gift card balances.
The good news is that most gift cards offered by PrizeRebel do not expire and have no associated inactivity fees. This means that you are free to use them whenever you want, however you want.[Accountswinn][1]
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
