March 4, 2022, 6:06 a.m. by mukeshkumar
Biological Motivation
I am novices to the field of Identity and Access management. Till now I know, Sail point has provided the some direct connectors to integrate the known systems like LDAP, HR systems, OIM, Databases.. And sailpoint also provided the support for disconnected applications with the use of Custom connectors. Here, My question is how to develop a custom connector..? I do not have jar file provided by sailpoint which contain "AbstractConnector" class. So that I can write my own class and develop..? I also so not understand, what to do with that class?(if i have a jar) How [sailpoint trainings][1] will refer to that class.. Do we need to deploy that class to somewhere...
Here I am expecting the complete flow to develop and deploy the custom connector.. If anyone is working please help).
...
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
