March 2, 2022, 2:15 p.m. by Angeline
Biological Motivation
Polygon (formerly Matic) is an Ethereum side chain that provides interoperability with layer-2 solutions. The option - [NFT marketplace development on Polygon][1] - adds seamless scalability to the marketplace platform. It also speeds up transactions, resulting in a significant increase in throughput. It also offers low transaction costs. On Polygon, an NFT marketplace uses highly secure technology and is easily accessible.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
