Suggested problems

A Rapid Introduction to Molecular Biology

USA,UK,UEA, Australia, All country ,We have a team of renowned assignment writers who have experience of providing law assignment writing service, thetutorshelp.com is 100% plagiarism free assignment provider. https://www.thetutorshelp.com/law-assignment-help.php

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21