Suggested problems

Biological Motivation

QuickBooks is the world's most well-known and commonly used accounting software. This software is mostly used by small and medium-sized organizations. It must first be installed on the system, which necessitates the completion of several tasks.

QuickBooks Desktop is accounting software with add-ons and industrial versions, akin to an ERP system. Integrated QuickBooks, Intuit Payroll, and third-party customer relationship management software like Salesforce and AP automation software programs are among the add-ons.

[1]: https://qberror.com/what-is-quickbooks/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21