Suggested problems

PayPal Clone Script | Why choose Our PayPal Clone?

Feb. 21, 2022, 8:22 a.m. by amelia davis

Biological Motivation

[PayPal clone][1]: Instant money transfers are vital in today's world, whether it's for an emergency or to send money to another nation. Because 20% of people spend money abroad for jobs, hospitals, education, tourism, and other reasons, it is increasingly vital to utilize our PayPal Clone Script. As a consequence, we can assure you that you can run a lucrative business from the ground up. Designed to provide immediate returns on the monetary business over time. A professional payment processor is just as necessary for processing transactions on a website as a professional cashier is for managing fund transfers in a physical business. We designed a PayPal clone script utilizing one of the most prominent payment processors on the web in order to perfectly reproduce all of PayPal's features. And we've created this script, which might be an excellent partner for processing all of your website's payments.

For more details visit our website:- [Paypal clone][2]

Call us at +1 585 457 5655

Know more: [PayPal Money Script][3] || [Open Source Paypal Clone][4] || [Payment Gateway Clone Script][5]

[1]: https://www.omninos.in/paypal-clone-app-script.php [2]: https://www.omninos.in/paypal-clone-app-script.php [3]: https://www.omninos.in/paypal-clone-app-script.php [4]: https://www.omninos.in/paypal-clone-app-script.php [5]: https://www.omninos.in/paypal-clone-app-script.php

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21